Post by: vox nihili on September 02, 2017, 10:26:57 pm
The multiple choice solutions are available at the end of the document. If you have any questions about these solutions (there are certainly some very tricky answers) ask them on this thread and I will do my best to explain why that's the case. I got 100% so I should be able to (hopefully) provide some explanation.
Solutions to the written section are provided. These are the answers that I quickly put together, and there may be other correct answers.
Corrections
These answers were compiled in ~20 minutes, so there will be some errors. If you disagree with an answer, let me know and I will add it here.
1b: Some of the details of this question are wrong. There are in fact four groups, showing a decrease in oxygen concentration. Thanks to Quantum.
5b: should read herd immunity, not artificial. This is a classic example of not having read the question in full and is a mistake that should be avoided on careful consideration of the questions. Thanks to Lifeisaconstantstruggle
6a: The correct sequence of the normal mRNA is: ACUGGAACUCCGGUCUUCAAACU, making the correct amino acid sequence: Thr-Gly-Thr-Pro-Val-Phe-Lys. Thanks to tim.c
Post by: vox nihili on September 03, 2017, 07:58:22 pm
Post by: VceBookworm on September 04, 2017, 08:40:57 pm
Any chance of you can repost please ?or send to my email ?
Post by: vox nihili on September 04, 2017, 10:04:17 pm
Thank you for taking the time to share the answers to the written parts but unfortunately I can't seem to get access - it opens with weird cryptic random numbers and alphabets
Any chance of you can repost please ?or send to my email ?
is anybody else having this problem?
I've just tried to download it myself without any troubles. What programme are you using to open the file?
Post by: Joseph41 on September 05, 2017, 08:55:54 am
is anybody else having this problem?
I've just tried to download it myself without any troubles. What programme are you using to open the file?
Works fine for me, VN.
Post by: Aakaash14 on September 05, 2017, 01:06:10 pm
Q11
Q17
Q19
Post by: vox nihili on September 05, 2017, 05:25:01 pm
Hey I have just finished doing the MCQs, can you please explain the following questions from MCQ:
Q11
Q17
Q19
Hey there :) doing this on the train so pull me up if I've said anything silly
Q11: the picture shows a mitochondrion. The correct answer is C, because NADH provides electrons and hydrogen ions (H+) to the electron transport chain, thus turning NADH into NAD+. This is called cycling because glycolysis will turn the NAD+ back into NADH.
Let me know if you'd like me to explain why the other alternatives are wrong
Q17: this was a challenging question. Lipid based hormones can go straight through the membrane. That is because the membrane is a lipid; therefore, they zip right through.
If they can go right through, it stands to reason that their receptors will be inside the cell.
These receptors bind to the lipid hormone. Once they have bound, the receptor and the hormone together move into the nucleus where they bind to DNA and alter the transcription of genes.
I was surprised by Q17. The knowledge required was surprisingly technical.
Q19: another technical question but absolutely fair game. Relenza is a dot point on the study design.
Flu virus gets into cells by sticking onto the surface. Once that happens, the cells then take the flu virus up by endocytosis.
The virus then replicates inside the cell, making 1000s of flu babies.
When these are ready to leave, they move out of the cell by exocytosis. The problem is, the same things that allow flu to stick to the cell to invade it, make all the flu babies get stuck to the cell from which they're coming. Therefore to infect another cell, they have to become unstuck.
An enzyme called neuraminidase achieves this by cutting the sticky bits off the cell, therefore allowing those viruses to go and infect other cells.
Relenza was developed by first solving the structure of neuraminidase. Then what we did is we had a look at what the active site of the enzyme looks like and designed a drug that could fit in there and block it.
Post by: chrissle on September 11, 2017, 09:17:46 am
I don't actually know the answer because my school didn't teach it :|
Post by: vox nihili on September 11, 2017, 11:21:28 am
How can PCR be the answer for the modern method of identifying the pathogen? This method simply amplifies the DNA. Wouldn't a better answer be gene probes or gene sequencing?
I don't actually know the answer because my school didn't teach it :|
Hey there :)
I thought this was a hard question and was surprised it was asked. The only reason I knew the answer is because I study medicine at the moment and this is actually how it's done :)
PCR can be used to amplify specific sequences of DNA. We do this by using probes that are specific to that DNA. In that way, you can choose a sequence for a bacterium to amplify. You'd then use gel electrophoresis to visualise the stretch of DNA you amplified with PCR. If the pathogen is in the blood sample, then you'll see the band on electrophoresis (because the DNA has been amplified) if it's not, the gel will be clear.
Post by: chrissle on September 11, 2017, 11:47:10 am
1. gene probes in sample to identify a specific sequence of DNA
2. amplify that DNA using PCR
3. Run DNA through gel electrophoresis
Post by: vox nihili on September 12, 2017, 03:20:00 pm
Thanks! ;D So to summarise the process is:
1. gene probes in sample to identify a specific sequence of DNA
2. amplify that DNA using PCR
3. Run DNA through gel electrophoresis
Effectively yes. Just remember that all PCR involves probes though, so you'd just say that the probes used in the PCR are specific to a sequence of interest :)
Post by: Quantum. on September 29, 2017, 03:28:27 pm
Post by: vox nihili on September 29, 2017, 06:57:22 pm
Just thought I'd mention that with 1b, there are only four groups being tested that instead indicate a decrease overall, and that with 7c, I think radiometric dating (uranium-lead) would be used for dating the rock preserving the fossil rather than the fossil itself? Otherwise, thank you so much for the solutions - they have been super helpful!
1b. Absolutely, will amend when I get home.
7c. Yes, kind of... you’re quite right that typically this kind radiometric dating is used to date the rock containing the fossil, rather than the fossil itself, but it can be used to date the fossil, too. Two examples of this: an imprint in rock (from a foot print for example) is itself a fossil. Likewise, the process of petrifaction sees organic matter replaced with minerals, which likewise can be dated by lead-uranium.
For those reading: carbon still does the fossil itself.
Anyway, it’s an interesting point you raise. One I hadn’t considered!
Thanks for looking over the answers, I’m glad there were only a couple of minor things
Post by: Quantum. on September 29, 2017, 07:36:57 pm
Post by: gemmaruffin on October 04, 2017, 08:38:20 pm
Post by: Eric11267 on October 04, 2017, 09:05:00 pm
Hey, just wondering if you could explain MC Q 15?I'm not a biology expert by any means, but I'll try to give you my interpretation.
The y-axis of the graph shows net uptake of carbon dioxide, which I assume to be carbon dioxide absorbed minus the carbon dioxide released. So at point M, the net uptake is 0, meaning the rate of absorption and rate of release are equal. Thus, the rates of photosynthesis and cellular respiration are the same
Post by: gemmaruffin on October 04, 2017, 10:08:08 pm
I'm not a biology expert by any means, but I'll try to give you my interpretation.
The y-axis of the graph shows net uptake of carbon dioxide, which I assume to be carbon dioxide absorbed minus the carbon dioxide released. So at point M, the net uptake is 0, meaning the rate of absorption and rate of release are equal. Thus, the rates of photosynthesis and cellular respiration are the same
thank you!!
Post by: vox nihili on October 04, 2017, 11:07:50 pm
I'm not a biology expert by any means, but I'll try to give you my interpretation.
The y-axis of the graph shows net uptake of carbon dioxide, which I assume to be carbon dioxide absorbed minus the carbon dioxide released. So at point M, the net uptake is 0, meaning the rate of absorption and rate of release are equal. Thus, the rates of photosynthesis and cellular respiration are the same
Sounds expert enough to me!
Gemma, the trick to this question was recognising that the negative carbon dioxide uptake was due to the rate of cellular respiration (which produces CO2) being greater than the rate of photosynthesis (consumes CO2).
Therefore, at 0 the rate of photosynthesis=respiration
This was a hard question.
Post by: tim.c on October 14, 2017, 09:11:35 pm
I'm a bit confused why question 1 in part A (multi choice) is C. It asks which one explains the functional diversity of proteins. Why isn't it B? B describes the diversity in functions whereas C doesn't talk about functions of the proteins at all.
Also with your solutions on Q6 a, isn't the mRNA sequence ACUGGAACUCCGGUCUUCAAACU? And hence the amino acids sequence is different
Post by: Sine on October 14, 2017, 09:29:48 pm
Thanks for that! Really helpful!q1 asks for the statement EXPLAINING functional diversity (not descriptions of it)
I'm a bit confused why question 1 in part A (multi choice) is C. It asks which one explains the functional diversity of proteins. Why isn't it B? B describes the diversity in functions whereas C doesn't talk about functions of the proteins at all.
Also with your solutions on Q6 a, isn't the mRNA sequence ACUGGAACUCCGGUCUUCAAACU? And hence the amino acids sequence is different
q6 which part of q6 where you referring to?
Post by: vox nihili on October 14, 2017, 09:38:35 pm
Thanks for that! Really helpful!
I'm a bit confused why question 1 in part A (multi choice) is C. It asks which one explains the functional diversity of proteins. Why isn't it B? B describes the diversity in functions whereas C doesn't talk about functions of the proteins at all.
Also with your solutions on Q6 a, isn't the mRNA sequence ACUGGAACUCCGGUCUUCAAACU? And hence the amino acids sequence is different
Yes, you're right about the mRNA. I used an online tool to transcribe it and made an error inputting the DNA sequence (missing the one cysteine it appears!). I'll make a note of it in the title post.
Post by: LifeisaConstantStruggle on October 15, 2017, 10:29:11 pm
5)b)i) Artificial immunity
Wouldn't the type of immunity the government is trying to achieve in the population with high vaccination rate be herd immunity instead? as 5)b)ii) also wants us to explain how this type of immunity can protect the 5% of the population who have not been vaccinated.
Thanks in advance :)
Post by: Sine on October 15, 2017, 10:32:34 pm
Hi I'm just here to check on a certain question (Q5 SA), I'm not sure if the sample answers are right or not.well the question says "trying to achieve in the POPULATION" not "trying to achieve in the INDIVIDUAL" so I agree with you.
5)b)i) Artificial immunity
Wouldn't the type of immunity the government is trying to achieve in the population with high vaccination rate be herd immunity instead? as 5)b)ii) also wants us to explain how this type of immunity can protect the 5% of the population who have not been vaccinated.
Thanks in advance :)
Post by: vox nihili on October 16, 2017, 08:05:29 am
Hi I'm just here to check on a certain question (Q5 SA), I'm not sure if the sample answers are right or not.
5)b)i) Artificial immunity
Wouldn't the type of immunity the government is trying to achieve in the population with high vaccination rate be herd immunity instead? as 5)b)ii) also wants us to explain how this type of immunity can protect the 5% of the population who have not been vaccinated.
Thanks in advance :)
Fair point—classic example of why you should always read the question in full
Thanks to those who have already suggested improvements to the answers. As in the title, I didn’t have a lot of time to put this set together, so the kind of silly mistakes you should avoid with the benefit of more time are inevitable. If you’re unsure of an answer, we’re more than happy to discuss. At best, you’ll have suggested an improvement and at worst you’ll have a deeper explanation about the question!
Post by: LifeisaConstantStruggle on October 16, 2017, 02:13:10 pm
I have passed my sample exam to an assessor and we'll probably discuss the answers of the exam. Would you mind if I edit the sample answers and upload a modified version of it? (I'll just add more possible solutions to the question and probably have explanations on the multiple choice questions as well)
The assessor will probably be done on Wednesday/Thursday, I might be able to upload the document by the weekends.
Post by: vox nihili on October 16, 2017, 08:52:40 pm
Thanks for the clarification vox!
I have passed my sample exam to an assessor and we'll probably discuss the answers of the exam. Would you mind if I edit the sample answers and upload a modified version of it? (I'll just add more possible solutions to the question and probably have explanations on the multiple choice questions as well)
The assessor will probably be done on Wednesday/Thursday, I might be able to upload the document by the weekends.
I think this is great; however, you need to discuss with the assessor. If it's their answers your going to contribute to the document, they have to be ok with that and need to be credited, too :)
Post by: LifeisaConstantStruggle on October 16, 2017, 09:04:47 pm
Post by: LifeisaConstantStruggle on October 25, 2017, 04:50:13 pm
Post by: Cloudy99 on October 27, 2017, 11:42:18 am
"The mean data. Individual data sets are more likely to influenced by errors or uncontrolled extraneous variables, averaging the data limits the influence of such factors."
im a bit confused :/
Post by: PhoenixxFire on October 27, 2017, 12:17:41 pm
We talked about it previously here
Post by: vox nihili on October 27, 2017, 01:29:03 pm
Edrolo’s reasoning is wrong. Their argument for averaging is that you combine data sets. Each data set is inherently prone to error; therefore, each one gives a fairly inaccurate view of what’s going on, on its own. However, what EdRolo have failed to recognise in presenting the raw data is that you don’t consider an individual data set. You consider multiple data sets together. By taking the average you hide important information, namely that 3/4 showed the change we expected, whereas 1 appears to have been subject to an experimental error.
The average leads us to the wrong conclusion. The raw data do not.
This is always the case. The average is only a narrow snapshot of raw data. The raw data will ALWAYS be more instructive. For someone looking at the raw data, if they want to know the average they can calculate it themselves. You can’t derive the raw data from an average though.
Post by: LifeisaConstantStruggle on October 28, 2017, 10:14:57 am
Post by: LifeisaConstantStruggle on October 28, 2017, 11:11:20 am
Post by: parharjasmine on October 29, 2017, 11:10:42 am
I don't seem to understand why the answer to 1)c is CO2 consumption? Isn't CO2 in fact released?
Thank you :)
Post by: LifeisaConstantStruggle on October 29, 2017, 11:23:06 am
Hello,Ah yes I have noticed this in the sample exam solutions as well. But I have changed it to CO2 levels instead of consumption in the solutions I have edited. So yeah :) sorry for not stating it here.
I don't seem to understand why the answer to 1)c is CO2 consumption? Isn't CO2 in fact released?
Thank you :)
Also, it's better to talk about any "change" in the level of substance we want to talk about because, we wouldn't know if the CO2 level has increased or decreased without any prior knowledge to the experiment.
Post by: vox nihili on October 29, 2017, 01:58:46 pm
Hello,
I don't seem to understand why the answer to 1)c is CO2 consumption? Isn't CO2 in fact released?
Thank you :)
I’ll change it when I get onto a computer, thank you :)
During my holidays I’ll probably try to clean up these sample answers. As I’ve mentioned, I only had about 20 minutes to do them so there are silly errors like that :)
Post by: Kateblain on October 29, 2017, 07:11:50 pm
Post by: LifeisaConstantStruggle on October 29, 2017, 07:19:10 pm
They did not word this well enough tbh, could've specified the type of DNA strand shown (template or coding).
Post by: PhoenixxFire on October 29, 2017, 07:47:21 pm
Hi, just wanted to ask about question 6b: why is the mRNA strand complementary to the DNA strand? Shouldn't it be the same (with U replacing T)?Not sure but the way you've worded this makes it sound like you think the mRNA strand is a copy of the template strand which is not the case. During transcription RNA polymerase builds a strand complementary to the template strand.
Post by: neenah on October 29, 2017, 09:54:48 pm
Post by: vox nihili on October 29, 2017, 10:11:11 pm
Hey can I just ask why in MCQ 14 A is more correct than D?
D is incorrect because photosynthesis starts when there's any light at all (x-axis). The y-axis just tells you about NET energy production. Below 0, the production is in the negative because the plant cells are using more energy in respiration than they're producing in photosynthesis. They are still producing energy by photosynthesis though even when it's in the negative!
Post by: zenith101 on October 30, 2017, 03:31:44 pm
for question 1 c i) should the answer be production of CO2, rather than consumption?. If not, why so, i'm a bit lost.
Also for q1 c)ii) would writing 'increasing temperature to allow optimal enzyme activity' be an acceptable answer?
Thanks
Post by: vox nihili on October 30, 2017, 03:46:12 pm
hey there,
for question 1 c i) should the answer be production of CO2, rather than consumption?. If not, why so, i'm a bit lost.
Also for q1 c)ii) would writing 'increasing temperature to allow optimal enzyme activity' be an acceptable answer?
Thanks
We addressed this a few posts above. Sorry about the confusion.
Yes. Although I wouldn't assume that an increase is needed to reach optimal temperature; it could be a decrease. Changing the temperature would suffice :)
Post by: banksduyvu on November 01, 2017, 06:13:18 pm
Post by: vox nihili on November 01, 2017, 06:50:08 pm
Why does cell burst causes inflammation? :))
Cells of the immune system, which drive inflammation, respond to bits of dead cell. When cells burst, dead bits of cell go flying everywhere triggering inflammation.
Post by: simrat99 on November 01, 2017, 07:25:33 pm
Post by: True Dat on November 02, 2017, 09:26:13 pm
To provide a standard to compare results to.
Post by: Sam M on November 02, 2017, 09:33:27 pm
For question 2a would this answer suffice?
To provide a standard to compare results to.
I don't think so. In my edrolo at least, the teacher made a point that you had to be specific to the question, and that such a generic answer would not gain any marks. (also do you mean 2b?)
Post by: True Dat on November 02, 2017, 09:56:42 pm
I don't think so. In my edrolo at least, the teacher made a point that you had to be specific to the question, and that such a generic answer would not gain any marks. (also do you mean 2b?)Oh yes 2b sorry. Been trying to reduce the wordiness of my answers, probably went a bit to far this time haha. Also with Question 5b wouldn't the answer be Herd Immunity instead of the broader Artificial immunity?
And for Question 2b would a better answer be :
To provide a known standard of bacterial growth in response to phenylalanine to compare results to.
Post by: Sam M on November 02, 2017, 09:58:37 pm
Oh yes 2b sorry. Been trying to reduce the wordiness of my answers, probably went a bit to far this time haha. Also with Question 5b wouldn't the answer be Herd Immunity instead of the broader Artificial immunity?
Yes. I think that is one of the corrections for the answers on the first page.
Post by: vox nihili on November 02, 2017, 11:00:35 pm
Yes. I think that is one of the corrections for the answers on the first page.
Yep! Apologies once again about some of the errors; they were very rushed and I knew I could rely on you guys to keep me on my toes :)
Post by: PhoenixxFire on October 28, 2018, 06:07:04 pm
Given there’s so many people asking for this, I figure it’s easier to just push it to the top.
Post by: tho0099 on November 10, 2020, 07:09:25 pm
i am able to access the pdf with the answers, however there are no multiple choice answers? i have looked at the bottom like you mentioned however i still cannot see them, any tips?
Post by: SmartWorker on November 10, 2020, 07:49:27 pm
Hello, thank you for providing the answers to this exam,
i am able to access the pdf with the answers, however there are no multiple choice answers? i have looked at the bottom like you mentioned however i still cannot see them, any tips?
MC can be found on the VCAA website ,here: https://www.vcaa.vic.edu.au/Documents/exams/biology/biology-samp-w.pdf
on the last page of the sample exam
Post by: Sinalih on November 12, 2020, 11:36:14 am
Post by: jointjason on October 23, 2021, 10:54:29 pm