VCE Stuff > VCE Biology
VCAA Sample Exam (2017) Solutions
vox nihili:
You can access the practice exam here
The multiple choice solutions are available at the end of the document. If you have any questions about these solutions (there are certainly some very tricky answers) ask them on this thread and I will do my best to explain why that's the case. I got 100% so I should be able to (hopefully) provide some explanation.
Solutions to the written section are provided. These are the answers that I quickly put together, and there may be other correct answers.
Corrections
These answers were compiled in ~20 minutes, so there will be some errors. If you disagree with an answer, let me know and I will add it here.
1b: Some of the details of this question are wrong. There are in fact four groups, showing a decrease in oxygen concentration. Thanks to Quantum.
5b: should read herd immunity, not artificial. This is a classic example of not having read the question in full and is a mistake that should be avoided on careful consideration of the questions. Thanks to Lifeisaconstantstruggle
6a: The correct sequence of the normal mRNA is: ACUGGAACUCCGGUCUUCAAACU, making the correct amino acid sequence: Thr-Gly-Thr-Pro-Val-Phe-Lys. Thanks to tim.c
vox nihili:
The title post has been updated with answers to the written section.
VceBookworm:
Thank you for taking the time to share the answers to the written parts but unfortunately I can't seem to get access - it opens with weird cryptic random numbers and alphabets
Any chance of you can repost please ?or send to my email ?
vox nihili:
--- Quote from: VceBookworm on September 04, 2017, 08:40:57 pm ---Thank you for taking the time to share the answers to the written parts but unfortunately I can't seem to get access - it opens with weird cryptic random numbers and alphabets
Any chance of you can repost please ?or send to my email ?
--- End quote ---
is anybody else having this problem?
I've just tried to download it myself without any troubles. What programme are you using to open the file?
Joseph41:
--- Quote from: vox nihili on September 04, 2017, 10:04:17 pm --- is anybody else having this problem?
I've just tried to download it myself without any troubles. What programme are you using to open the file?
--- End quote ---
Works fine for me, VN.
Navigation
[0] Message Index
[#] Next page
Go to full version