VCE Stuff > VCE Biology
VCAA Sample Exam (2017) Solutions
Eric11267:
--- Quote from: gemmaruffin on October 04, 2017, 08:38:20 pm ---Hey, just wondering if you could explain MC Q 15?
--- End quote ---
I'm not a biology expert by any means, but I'll try to give you my interpretation.
The y-axis of the graph shows net uptake of carbon dioxide, which I assume to be carbon dioxide absorbed minus the carbon dioxide released. So at point M, the net uptake is 0, meaning the rate of absorption and rate of release are equal. Thus, the rates of photosynthesis and cellular respiration are the same
gemmaruffin:
--- Quote from: Eric11267 on October 04, 2017, 09:05:00 pm ---I'm not a biology expert by any means, but I'll try to give you my interpretation.
The y-axis of the graph shows net uptake of carbon dioxide, which I assume to be carbon dioxide absorbed minus the carbon dioxide released. So at point M, the net uptake is 0, meaning the rate of absorption and rate of release are equal. Thus, the rates of photosynthesis and cellular respiration are the same
--- End quote ---
thank you!!
vox nihili:
--- Quote from: Eric11267 on October 04, 2017, 09:05:00 pm ---I'm not a biology expert by any means, but I'll try to give you my interpretation.
The y-axis of the graph shows net uptake of carbon dioxide, which I assume to be carbon dioxide absorbed minus the carbon dioxide released. So at point M, the net uptake is 0, meaning the rate of absorption and rate of release are equal. Thus, the rates of photosynthesis and cellular respiration are the same
--- End quote ---
Sounds expert enough to me!
Gemma, the trick to this question was recognising that the negative carbon dioxide uptake was due to the rate of cellular respiration (which produces CO2) being greater than the rate of photosynthesis (consumes CO2).
Therefore, at 0 the rate of photosynthesis=respiration
This was a hard question.
tim.c:
Thanks for that! Really helpful!
I'm a bit confused why question 1 in part A (multi choice) is C. It asks which one explains the functional diversity of proteins. Why isn't it B? B describes the diversity in functions whereas C doesn't talk about functions of the proteins at all.
Also with your solutions on Q6 a, isn't the mRNA sequence ACUGGAACUCCGGUCUUCAAACU? And hence the amino acids sequence is different
Sine:
--- Quote from: tim.c on October 14, 2017, 09:11:35 pm ---Thanks for that! Really helpful!
I'm a bit confused why question 1 in part A (multi choice) is C. It asks which one explains the functional diversity of proteins. Why isn't it B? B describes the diversity in functions whereas C doesn't talk about functions of the proteins at all.
Also with your solutions on Q6 a, isn't the mRNA sequence ACUGGAACUCCGGUCUUCAAACU? And hence the amino acids sequence is different
--- End quote ---
q1 asks for the statement EXPLAINING functional diversity (not descriptions of it)
q6 which part of q6 where you referring to?
Navigation
[0] Message Index
[#] Next page
[*] Previous page
Go to full version