Login

Welcome, Guest. Please login or register.

April 29, 2024, 12:06:55 am

Author Topic: VCAA Sample Exam (2017) Solutions  (Read 39668 times)  Share 

0 Members and 1 Guest are viewing this topic.

Eric11267

  • Trendsetter
  • **
  • Posts: 118
  • Today three of my enemies I shall strike dead
  • Respect: +41
Re: VCAA Sample Exam (2017) Solutions
« Reply #15 on: October 04, 2017, 09:05:00 pm »
+4
Hey, just wondering if you could explain MC Q 15?
I'm not a biology expert by any means, but I'll try to give you my interpretation.
The y-axis of the graph shows net uptake of carbon dioxide, which I assume to be carbon dioxide absorbed minus the carbon dioxide released. So at point M, the net uptake is 0, meaning the rate of absorption and rate of release are equal. Thus, the rates of photosynthesis and cellular respiration are the same

gemmaruffin

  • Forum Regular
  • **
  • Posts: 87
  • Respect: +53
Re: VCAA Sample Exam (2017) Solutions
« Reply #16 on: October 04, 2017, 10:08:08 pm »
0
I'm not a biology expert by any means, but I'll try to give you my interpretation.
The y-axis of the graph shows net uptake of carbon dioxide, which I assume to be carbon dioxide absorbed minus the carbon dioxide released. So at point M, the net uptake is 0, meaning the rate of absorption and rate of release are equal. Thus, the rates of photosynthesis and cellular respiration are the same

thank you!!
2016 - HHD (49)
2017 - Bio (41), Chem, Italian, English (43), Methods

Happy to help out with any HHD questions, and remember - there is life after VCE :)

vox nihili

  • National Moderator
  • Great Wonder of ATAR Notes
  • *****
  • Posts: 5343
  • Respect: +1447
Re: VCAA Sample Exam (2017) Solutions
« Reply #17 on: October 04, 2017, 11:07:50 pm »
+2

I'm not a biology expert by any means, but I'll try to give you my interpretation.
The y-axis of the graph shows net uptake of carbon dioxide, which I assume to be carbon dioxide absorbed minus the carbon dioxide released. So at point M, the net uptake is 0, meaning the rate of absorption and rate of release are equal. Thus, the rates of photosynthesis and cellular respiration are the same

Sounds expert enough to me!

Gemma, the trick to this question was recognising that the negative carbon dioxide uptake was due to the rate of cellular respiration (which produces CO2) being greater than the rate of photosynthesis (consumes CO2).

Therefore, at 0 the rate of photosynthesis=respiration

This was a hard question. 
2013-15: BBiomed (Biochemistry and Molecular Biology), UniMelb
2016-20: MD, UniMelb
2019-20: MPH, UniMelb
2021-: GDipBiostat, USyd

tim.c

  • Fresh Poster
  • *
  • Posts: 1
  • Respect: 0
Re: VCAA Sample Exam (2017) Solutions
« Reply #18 on: October 14, 2017, 09:11:35 pm »
0
Thanks for that! Really helpful!

I'm a bit confused why question 1 in part A (multi choice) is C. It asks which one explains the functional diversity of proteins. Why isn't it B? B describes the diversity in functions whereas C doesn't talk about functions of the proteins at all.

Also with your solutions on Q6 a, isn't the mRNA sequence ACUGGAACUCCGGUCUUCAAACU? And hence the amino acids sequence is different
« Last Edit: October 14, 2017, 09:21:50 pm by tim.c »

Sine

  • Werewolf
  • National Moderator
  • Great Wonder of ATAR Notes
  • *****
  • Posts: 5135
  • Respect: +2103
Re: VCAA Sample Exam (2017) Solutions
« Reply #19 on: October 14, 2017, 09:29:48 pm »
0
Thanks for that! Really helpful!

I'm a bit confused why question 1 in part A (multi choice) is C. It asks which one explains the functional diversity of proteins. Why isn't it B? B describes the diversity in functions whereas C doesn't talk about functions of the proteins at all.

Also with your solutions on Q6 a, isn't the mRNA sequence ACUGGAACUCCGGUCUUCAAACU? And hence the amino acids sequence is different
q1 asks for the statement EXPLAINING functional diversity (not descriptions of it)
q6 which part of q6 where you referring to?


vox nihili

  • National Moderator
  • Great Wonder of ATAR Notes
  • *****
  • Posts: 5343
  • Respect: +1447
Re: VCAA Sample Exam (2017) Solutions
« Reply #20 on: October 14, 2017, 09:38:35 pm »
+1
Thanks for that! Really helpful!

I'm a bit confused why question 1 in part A (multi choice) is C. It asks which one explains the functional diversity of proteins. Why isn't it B? B describes the diversity in functions whereas C doesn't talk about functions of the proteins at all.

Also with your solutions on Q6 a, isn't the mRNA sequence ACUGGAACUCCGGUCUUCAAACU? And hence the amino acids sequence is different

Yes, you're right about the mRNA. I used an online tool to transcribe it and made an error inputting the DNA sequence (missing the one cysteine it appears!). I'll make a note of it in the title post.
2013-15: BBiomed (Biochemistry and Molecular Biology), UniMelb
2016-20: MD, UniMelb
2019-20: MPH, UniMelb
2021-: GDipBiostat, USyd

LifeisaConstantStruggle

  • Forum Obsessive
  • ***
  • Posts: 324
  • Respect: +104
Re: VCAA Sample Exam (2017) Solutions
« Reply #21 on: October 15, 2017, 10:29:11 pm »
+1
Hi I'm just here to check on a certain question (Q5 SA), I'm not sure if the sample answers are right or not.
5)b)i) Artificial immunity
Wouldn't the type of immunity the government is trying to achieve in the population with high vaccination rate be herd immunity instead? as 5)b)ii) also wants us to explain how this type of immunity can protect the 5% of the population who have not been vaccinated.
Thanks in advance :)
2018-2020: Bachelor of Actuarial Science (+ Econometrics), Monash
2021: Bachelor of Commerce (Honours), Econometrics & Financial Mathematics, Monash
2022-2023: Work and some soul-searching

Sine

  • Werewolf
  • National Moderator
  • Great Wonder of ATAR Notes
  • *****
  • Posts: 5135
  • Respect: +2103
Re: VCAA Sample Exam (2017) Solutions
« Reply #22 on: October 15, 2017, 10:32:34 pm »
0
Hi I'm just here to check on a certain question (Q5 SA), I'm not sure if the sample answers are right or not.
5)b)i) Artificial immunity
Wouldn't the type of immunity the government is trying to achieve in the population with high vaccination rate be herd immunity instead? as 5)b)ii) also wants us to explain how this type of immunity can protect the 5% of the population who have not been vaccinated.
Thanks in advance :)
well the question says "trying to achieve in the POPULATION" not "trying to achieve in the INDIVIDUAL" so I agree with you.


vox nihili

  • National Moderator
  • Great Wonder of ATAR Notes
  • *****
  • Posts: 5343
  • Respect: +1447
VCAA Sample Exam (2017) Solutions
« Reply #23 on: October 16, 2017, 08:05:29 am »
+5
Hi I'm just here to check on a certain question (Q5 SA), I'm not sure if the sample answers are right or not.
5)b)i) Artificial immunity
Wouldn't the type of immunity the government is trying to achieve in the population with high vaccination rate be herd immunity instead? as 5)b)ii) also wants us to explain how this type of immunity can protect the 5% of the population who have not been vaccinated.
Thanks in advance :)

Fair point—classic example of why you should always read the question in full


Thanks to those who have already suggested improvements to the answers. As in the title, I didn’t have a lot of time to put this set together, so the kind of silly mistakes you should avoid with the benefit of more time are inevitable. If you’re unsure of an answer, we’re more than happy to discuss. At best, you’ll have suggested an improvement and at worst you’ll have a deeper explanation about the question!
« Last Edit: October 16, 2017, 08:09:29 am by vox nihili »
2013-15: BBiomed (Biochemistry and Molecular Biology), UniMelb
2016-20: MD, UniMelb
2019-20: MPH, UniMelb
2021-: GDipBiostat, USyd

LifeisaConstantStruggle

  • Forum Obsessive
  • ***
  • Posts: 324
  • Respect: +104
Re: VCAA Sample Exam (2017) Solutions
« Reply #24 on: October 16, 2017, 02:13:10 pm »
0
Thanks for the clarification vox!
I have passed my sample exam to an assessor and we'll probably discuss the answers of the exam. Would you mind if I edit the sample answers and upload a modified version of it? (I'll just add more possible solutions to the question and probably have explanations on the multiple choice questions as well)
The assessor will probably be done on Wednesday/Thursday, I might be able to upload the document by the weekends.
2018-2020: Bachelor of Actuarial Science (+ Econometrics), Monash
2021: Bachelor of Commerce (Honours), Econometrics & Financial Mathematics, Monash
2022-2023: Work and some soul-searching

vox nihili

  • National Moderator
  • Great Wonder of ATAR Notes
  • *****
  • Posts: 5343
  • Respect: +1447
Re: VCAA Sample Exam (2017) Solutions
« Reply #25 on: October 16, 2017, 08:52:40 pm »
+1
Thanks for the clarification vox!
I have passed my sample exam to an assessor and we'll probably discuss the answers of the exam. Would you mind if I edit the sample answers and upload a modified version of it? (I'll just add more possible solutions to the question and probably have explanations on the multiple choice questions as well)
The assessor will probably be done on Wednesday/Thursday, I might be able to upload the document by the weekends.

I think this is great; however, you need to discuss with the assessor. If it's their answers your going to contribute to the document, they have to be ok with that and need to be credited, too :)
2013-15: BBiomed (Biochemistry and Molecular Biology), UniMelb
2016-20: MD, UniMelb
2019-20: MPH, UniMelb
2021-: GDipBiostat, USyd

LifeisaConstantStruggle

  • Forum Obsessive
  • ***
  • Posts: 324
  • Respect: +104
Re: VCAA Sample Exam (2017) Solutions
« Reply #26 on: October 16, 2017, 09:04:47 pm »
0
Yeah I've talked to her about it, and she's willing to contribute :)
2018-2020: Bachelor of Actuarial Science (+ Econometrics), Monash
2021: Bachelor of Commerce (Honours), Econometrics & Financial Mathematics, Monash
2022-2023: Work and some soul-searching

LifeisaConstantStruggle

  • Forum Obsessive
  • ***
  • Posts: 324
  • Respect: +104
Re: VCAA Sample Exam (2017) Solutions
« Reply #27 on: October 25, 2017, 04:50:13 pm »
0
so sorry bout the delay :( but my teacher has yet to complete marking (she's real busy and stuff so yeah) my sample exam, but I've done the multiple choice solutions+a bit of the short answer (there are still some answers that need a bit of modification I think, I'm not sure) but I'll be done by tomorrow, hopefully.
2018-2020: Bachelor of Actuarial Science (+ Econometrics), Monash
2021: Bachelor of Commerce (Honours), Econometrics & Financial Mathematics, Monash
2022-2023: Work and some soul-searching

Cloudy99

  • Adventurer
  • *
  • Posts: 6
  • Respect: 0
Re: VCAA Sample Exam (2017) Solutions
« Reply #28 on: October 27, 2017, 11:42:18 am »
0
Can someone explain Quesion 1B, the question about the raw/mean data, the sample solutions says raw data but the suggested solution on edrolo says
"The mean data. Individual data sets are more likely to influenced by errors or uncontrolled extraneous variables, averaging the data limits the influence of such factors."
im a bit confused :/

PhoenixxFire

  • VIC MVP - 2018
  • Honorary Moderator
  • ATAR Notes Legend
  • *******
  • Posts: 3695
  • They/them/theirs
  • Respect: +3102
Re: VCAA Sample Exam (2017) Solutions
« Reply #29 on: October 27, 2017, 12:17:41 pm »
0
There are lots of disagreements on that question. Generally what I've heard it that vcaa would avoid something like that on an actual exam and that you would get marks for your reasoning not which you picked. I haven't read the question myself but I've been told that in the context averaging it would make both groups results the same.

We talked about it previously here
« Last Edit: October 27, 2017, 12:21:29 pm by PhoenixxFire »
2019: B. Environment and Sustainability/B. Science @ ANU
2020: Just Vibing
2021: B. Paramedicine/B. Nursing @ ACU Canberra