Login

Welcome, Guest. Please login or register.

October 05, 2026, 11:01:17 pm

Author Topic: VCAA Sample Exam (2017) Solutions  (Read 85414 times)  Share 

0 Members and 1 Guest are viewing this topic.

vox nihili

  • National Moderator
  • Great Wonder of ATAR Notes
  • *****
  • Posts: 5343
  • Respect: +1447
VCAA Sample Exam (2017) Solutions
« on: September 02, 2017, 10:26:57 pm »
+25
You can access the practice exam here


The multiple choice solutions are available at the end of the document. If you have any questions about these solutions (there are certainly some very tricky answers) ask them on this thread and I will do my best to explain why that's the case. I got 100% so I should be able to (hopefully) provide some explanation.

Solutions to the written section are provided. These are the answers that I quickly put together, and there may be other correct answers.

Corrections

These answers were compiled in ~20 minutes, so there will be some errors. If you disagree with an answer, let me know and I will add it here.

1b: Some of the details of this question are wrong. There are in fact four groups, showing a decrease in oxygen concentration. Thanks to Quantum.
5b: should read herd immunity, not artificial. This is a classic example of not having read the question in full and is a mistake that should be avoided on careful consideration of the questions. Thanks to Lifeisaconstantstruggle
6a: The correct sequence of the normal mRNA is: ACUGGAACUCCGGUCUUCAAACU, making the correct amino acid sequence: Thr-Gly-Thr-Pro-Val-Phe-Lys. Thanks to tim.c
« Last Edit: October 16, 2017, 08:07:27 am by vox nihili »
2013-15: BBiomed (Biochemistry and Molecular Biology), UniMelb
2016-20: MD, UniMelb
2019-20: MPH, UniMelb
2021-: GDipBiostat, USyd

vox nihili

  • National Moderator
  • Great Wonder of ATAR Notes
  • *****
  • Posts: 5343
  • Respect: +1447
Re: VCAA Sample Exam (2017) Solutions
« Reply #1 on: September 03, 2017, 07:58:22 pm »
+9
The title post has been updated with answers to the written section.
2013-15: BBiomed (Biochemistry and Molecular Biology), UniMelb
2016-20: MD, UniMelb
2019-20: MPH, UniMelb
2021-: GDipBiostat, USyd

VceBookworm

  • Adventurer
  • *
  • Posts: 19
  • Respect: 0
Re: VCAA Sample Exam (2017) Solutions
« Reply #2 on: September 04, 2017, 08:40:57 pm »
0
Thank you for taking the time to share the answers to the written parts but unfortunately I can't seem to get access - it opens with weird cryptic random numbers and alphabets
Any chance of you can repost please ?or send to my email ?

vox nihili

  • National Moderator
  • Great Wonder of ATAR Notes
  • *****
  • Posts: 5343
  • Respect: +1447
Re: VCAA Sample Exam (2017) Solutions
« Reply #3 on: September 04, 2017, 10:04:17 pm »
+1
Thank you for taking the time to share the answers to the written parts but unfortunately I can't seem to get access - it opens with weird cryptic random numbers and alphabets
Any chance of you can repost please ?or send to my email ?

is anybody else having this problem?

I've just tried to download it myself without any troubles. What programme are you using to open the file?
2013-15: BBiomed (Biochemistry and Molecular Biology), UniMelb
2016-20: MD, UniMelb
2019-20: MPH, UniMelb
2021-: GDipBiostat, USyd

Joseph41

  • Administrator
  • Great Wonder of ATAR Notes
  • *****
  • Posts: 10823
  • Respect: +7477
Re: VCAA Sample Exam (2017) Solutions
« Reply #4 on: September 05, 2017, 08:55:54 am »
0
is anybody else having this problem?

I've just tried to download it myself without any troubles. What programme are you using to open the file?

Works fine for me, VN.

Oxford comma, Garamond, Avett Brothers, Orla Gartland enthusiast.

Aakaash14

  • Fresh Poster
  • *
  • Posts: 1
  • Respect: 0
Re: VCAA Sample Exam (2017) Solutions
« Reply #5 on: September 05, 2017, 01:06:10 pm »
0
Hey I have just finished doing the MCQs, can you please explain the following questions from MCQ:
Q11
Q17
Q19


vox nihili

  • National Moderator
  • Great Wonder of ATAR Notes
  • *****
  • Posts: 5343
  • Respect: +1447
Re: VCAA Sample Exam (2017) Solutions
« Reply #6 on: September 05, 2017, 05:25:01 pm »
+5

Hey I have just finished doing the MCQs, can you please explain the following questions from MCQ:
Q11
Q17
Q19

Hey there :) doing this on the train so pull me up if I've said anything silly


Q11: the picture shows a mitochondrion. The correct answer is C, because NADH provides electrons and hydrogen ions (H+) to the electron transport chain, thus turning NADH into NAD+. This is called cycling because glycolysis will turn the NAD+ back into NADH.
Let me know if you'd like me to explain why the other alternatives are wrong

Q17: this was a challenging question. Lipid based hormones can go straight through the membrane. That is because the membrane is a lipid; therefore, they zip right through.
If they can go right through, it stands to reason that their receptors will be inside the cell.
These receptors bind to the lipid hormone. Once they have bound, the receptor and the hormone together move into the nucleus where they bind to DNA and alter the transcription of genes.

I was surprised by Q17. The knowledge required was surprisingly technical.

Q19: another technical question but absolutely fair game. Relenza is a dot point on the study design.
Flu virus gets into cells by sticking onto the surface. Once that happens, the cells then take the flu virus up by endocytosis.
The virus then replicates inside the cell, making 1000s of flu babies.
When these are ready to leave, they move out of the cell by exocytosis. The problem is, the same things that allow flu to stick to the cell to invade it, make all the flu babies get stuck to the cell from which they're coming. Therefore to infect another cell, they have to become unstuck.
An enzyme called neuraminidase achieves this by cutting the sticky bits off the cell, therefore allowing those viruses to go and infect other cells.

Relenza was developed by first solving the structure of neuraminidase. Then what we did is we had a look at what the active site of the enzyme looks like and designed a drug that could fit in there and block it.
2013-15: BBiomed (Biochemistry and Molecular Biology), UniMelb
2016-20: MD, UniMelb
2019-20: MPH, UniMelb
2021-: GDipBiostat, USyd

chrissle

  • Fresh Poster
  • *
  • Posts: 2
  • Respect: 0
Re: VCAA Sample Exam (2017) Solutions
« Reply #7 on: September 11, 2017, 09:17:46 am »
0
How can PCR be the answer for the modern method of identifying the pathogen? This method simply amplifies the DNA. Wouldn't a better answer be gene probes or gene sequencing?

I don't actually know the answer because my school didn't teach it :|

vox nihili

  • National Moderator
  • Great Wonder of ATAR Notes
  • *****
  • Posts: 5343
  • Respect: +1447
Re: VCAA Sample Exam (2017) Solutions
« Reply #8 on: September 11, 2017, 11:21:28 am »
+3

How can PCR be the answer for the modern method of identifying the pathogen? This method simply amplifies the DNA. Wouldn't a better answer be gene probes or gene sequencing?

I don't actually know the answer because my school didn't teach it :|

Hey there :)

I thought this was a hard question and was surprised it was asked. The only reason I knew the answer is because I study medicine at the moment and this is actually how it's done :)

PCR can be used to amplify specific sequences of DNA. We do this by using probes that are specific to that DNA. In that way, you can choose a sequence for a bacterium to amplify. You'd then use gel electrophoresis to visualise the stretch of DNA you amplified with PCR. If the pathogen is in the blood sample, then you'll see the band on electrophoresis (because the DNA has been amplified) if it's not, the gel will be clear.
2013-15: BBiomed (Biochemistry and Molecular Biology), UniMelb
2016-20: MD, UniMelb
2019-20: MPH, UniMelb
2021-: GDipBiostat, USyd

chrissle

  • Fresh Poster
  • *
  • Posts: 2
  • Respect: 0
Re: VCAA Sample Exam (2017) Solutions
« Reply #9 on: September 11, 2017, 11:47:10 am »
0
Thanks!  ;D So to summarise the process is:
1. gene probes in sample to identify a specific sequence of DNA
2. amplify that DNA using PCR
3. Run DNA through gel electrophoresis

vox nihili

  • National Moderator
  • Great Wonder of ATAR Notes
  • *****
  • Posts: 5343
  • Respect: +1447
Re: VCAA Sample Exam (2017) Solutions
« Reply #10 on: September 12, 2017, 03:20:00 pm »
+3
Thanks!  ;D So to summarise the process is:
1. gene probes in sample to identify a specific sequence of DNA
2. amplify that DNA using PCR
3. Run DNA through gel electrophoresis

Effectively yes. Just remember that all PCR involves probes though, so you'd just say that the probes used in the PCR are specific to a sequence of interest :)
2013-15: BBiomed (Biochemistry and Molecular Biology), UniMelb
2016-20: MD, UniMelb
2019-20: MPH, UniMelb
2021-: GDipBiostat, USyd

Quantum.

  • Fresh Poster
  • *
  • Posts: 4
  • Reality is far beyond human perception.
  • Respect: 0
Re: VCAA Sample Exam (2017) Solutions
« Reply #11 on: September 29, 2017, 03:28:27 pm »
0
Just thought I'd mention that with 1b, there are only four groups being tested that instead indicate a decrease overall, and that with 7c, I think radiometric dating (uranium-lead) would be used for dating the rock preserving the fossil rather than the fossil itself? Otherwise, thank you so much for the solutions - they have been super helpful!
2017 Legal Studies | Biology
2018 English | Chinese SL | Chemistry | Methods | Psychology

vox nihili

  • National Moderator
  • Great Wonder of ATAR Notes
  • *****
  • Posts: 5343
  • Respect: +1447
Re: VCAA Sample Exam (2017) Solutions
« Reply #12 on: September 29, 2017, 06:57:22 pm »
+3

Just thought I'd mention that with 1b, there are only four groups being tested that instead indicate a decrease overall, and that with 7c, I think radiometric dating (uranium-lead) would be used for dating the rock preserving the fossil rather than the fossil itself? Otherwise, thank you so much for the solutions - they have been super helpful!

1b. Absolutely, will amend when I get home.

7c. Yes, kind of... you’re quite right that typically this kind radiometric dating is used to date the rock containing the fossil, rather than the fossil itself, but it can be used to date the fossil, too. Two examples of this: an imprint in rock (from a foot print for example) is itself a fossil. Likewise, the process of petrifaction sees organic matter replaced with minerals, which likewise can be dated by lead-uranium.
For those reading: carbon still does the fossil itself.
Anyway, it’s an interesting point you raise. One I hadn’t considered!

Thanks for looking over the answers, I’m glad there were only a couple of minor things
2013-15: BBiomed (Biochemistry and Molecular Biology), UniMelb
2016-20: MD, UniMelb
2019-20: MPH, UniMelb
2021-: GDipBiostat, USyd

Quantum.

  • Fresh Poster
  • *
  • Posts: 4
  • Reality is far beyond human perception.
  • Respect: 0
Re: VCAA Sample Exam (2017) Solutions
« Reply #13 on: September 29, 2017, 07:36:57 pm »
0
Thanks for the explanation - that makes a lot of sense! Can't wait for this year's actual exam 😅
2017 Legal Studies | Biology
2018 English | Chinese SL | Chemistry | Methods | Psychology

gemmaruffin

  • Forum Regular
  • **
  • Posts: 87
  • Respect: +53
Re: VCAA Sample Exam (2017) Solutions
« Reply #14 on: October 04, 2017, 08:38:20 pm »
0
Hey, just wondering if you could explain MC Q 15?
2016 - HHD (49)
2017 - Bio (41), Chem, Italian, English (43), Methods

Happy to help out with any HHD questions, and remember - there is life after VCE :)