VCE Biology Question Thread

[cosine]

YesNot sure what you mean by this. Allele frequency is, overall, out of 1. A certain allele may increase/decrease in its frequency.It's not entirely incorrect, but examiners may take a mark off.

Oh.... I get it.. Because we are speaking of allele frequency, the allele frequency of 'f' may decrease randomly, meaning the frequency of allele F will increase, right? So thats why the answer is incorrect, because I said decrease?

I think I was meant to say there would be a decrease in genetic variation because some alleles are non-selectively being reduced, and so other alleles are being increased, relatively right? 

[Sine]

So genetic drift is the change in the allele frequency due to random events, then what is gene flow? Is that change in allele frequency due to migration?

Also can you give me an example of genetic drift where the allele frequency is changed, but is not decreased?

So would my original answer have gotten 1 mark for the explanation?

Thanks

I would rather say define genetic drift as "the change of allele frequencies as a result of CHANCE"

Gene Flow: "the movement of genes in and out of a population" ---->So when populations are isolated no gene flow occurs.

Population of cows: RR Red coat: WW White coat: RW Roan coat (can't really remember the exact alleles)
                                So say we have a population with 4 Red coats,4 Roan coat, 2 White coat
                                Allele frequencies: R-0.6 W-0.4
                                Say two Roan coat cows breed and produce 2 cows homozygous for Red. (And these parents die)
Now we have 6Red:2Roan:2White
New Allele Frequencies are: R-0.7 & W-0.3

So this was apparent because it was a small population, if these had happened in say a very large population(200 cows), their would be little or no change of allele Frequencies.

[cosine]

How much we need to know about apoptosis? Besides it is programmed cell death??

[Sine]

How much we need to know about apoptosis? Besides it is programmed cell death??

I'm not too sure about whether we need to know this but I just learned the general process.

-Cell is no longer required
-Cell develops blebs and starts to shrink
-caspase enzymes break down the mitochondria and nucleus(they contain DNA(probably defective)) all other organelles are recycled
-Cell is broken into vesicles
-Vesicles are engulfed by phagocytes
-Phagocytes release cytokines which makes sure all cells in that vicinity are not impacted(hurt)

Probably don't need to know this detail.

Also make sure you know the difference between necrosis and apoptosis--->necrosis is destruction of a cell due to injury or disease

[vox nihili]

I'm not too sure about whether we need to know this but I just learned the general process.

-Cell is no longer required
-Cell develops blebs and starts to shrink
-caspase enzymes break down the mitochondria and nucleus(they contain DNA(probably defective)) all other organelles are recycled
-Cell is broken into vesicles
-Vesicles are engulfed by phagocytes
-Phagocytes release cytokines which makes sure all cells in that vicinity are not impacted(hurt)

Probably don't need to know this detail.

Also make sure you know the difference between necrosis and apoptosis--->necrosis is destruction of a cell due to injury or disease

Would advise steering clear of going into the details. These are all correct, for the most part, but a bit out of order.

As far as I know, I think you need to know what it is, why it occurs and how it differs from necrosis. Just know that apoptosis is basically a "good" form of cell death, that doesn't make everything go nuts.

I would rather say define genetic drift as "the change of allele frequencies as a result of CHANCE"

Gene Flow: "the movement of genes in and out of a population" ---->So when populations are isolated no gene flow occurs.

Population of cows: RR Red coat: WW White coat: RW Roan coat (can't really remember the exact alleles)
                                So say we have a population with 4 Red coats,4 Roan coat, 2 White coat
                                Allele frequencies: R-0.6 W-0.4
                                Say two Roan coat cows breed and produce 2 cows homozygous for Red. (And these parents die)
Now we have 6Red:2Roan:2White
New Allele Frequencies are: R-0.7 & W-0.3

So this was apparent because it was a small population, if these had happened in say a very large population(200 cows), their would be little or no change of allele Frequencies.

I agree, chance is a better way to describe it. Random events are usually drivers of natural selection (e.g. drought).

[cosine]

Would advise steering clear of going into the details. These are all correct, for the most part, but a bit out of order.

As far as I know, I think you need to know what it is, why it occurs and how it differs from necrosis. Just know that apoptosis is basically a "good" form of cell death, that doesn't make everything go nuts.

I agree, chance is a better way to describe it. Random events are usually drivers of natural selection (e.g. drought).

But natural selection is selectively favouring certain phenotypes, that is not chance? Or in other words, drought is not natural selection, because whether you are favoured for something or not, no water means no life?

Also for apoptosis, are you sure that all organelles are recycled besides mitochondria and nucleus? And how does a cell receive a signal to die, is it an intracellular or extracellular signal?

And regarding transcription, do we need to know about the poly A and methylated cap that are added onto the pre-mRNA and splicing of introns in order to produce the final mRNA messenger molecule?

[HighTide]

But natural selection is selectively favouring certain phenotypes, that is not chance? Or in other words, drought is not natural selection, because whether you are favoured for something or not, no water means no life?

Also for apoptosis, are you sure that all organelles are recycled besides mitochondria and nucleus? And how does a cell receive a signal to die, is it an intracellular or extracellular signal?

And regarding transcription, do we need to know about the poly A and methylated cap that are added onto the pre-mRNA and splicing of introns in order to produce the final mRNA messenger molecule?

Natural selection uses environmental selection pressures to select for the most well adapted organisms to pass on their genetic material to the next generation. Personally, I don't fully agree that drought isn't natural selection. In a period of drought, the organisms which are capable of reaching water from other resources, or maintaining the water they have, are probably the most well adapted.
A quick google search came up with this result;
http://examples.yourdictionary.com/examples-of-natural-selection.html
If you have a read it says the Galapagos finches which were larger were better adapted to the drought conditions, whilst smaller ones were triumphed in rainy seasons.
Apoptosis can be controlled by intracellular and extracellular signals. If DNA is damaged in replication, the cell can cause its own death by apoptosis. Alternatively, an extracellular signal can cause the death of a cell if it is damaged or no longer needed. The cascade of reactions occurring to cause the cell death happens inside the cell.
Yh, the components of a cell undergone apoptosis are recycled.
Yes you do. So basically DNA--> pre-mRNA --> mRNA. pre-mRNA to mRNA there are a few steps. A methylated guanosine cap is attached to the 5' end. poly-A tail is attached to the 3' end. Splicosomes remove the introns.
I don't think the splicosomes is on the syllabus but the rest is I'm sure.
Enjoy 

[cosine]

How much do we need to know about start and stop codons?
What are rRNA involved in, in terms of VCE?

[vox nihili]

But natural selection is selectively favouring certain phenotypes, that is not chance? Or in other words, drought is not natural selection, because whether you are favoured for something or not, no water means no life?

Also for apoptosis, are you sure that all organelles are recycled besides mitochondria and nucleus? And how does a cell receive a signal to die, is it an intracellular or extracellular signal?

And regarding transcription, do we need to know about the poly A and methylated cap that are added onto the pre-mRNA and splicing of introns in order to produce the final mRNA messenger molecule?

Just to be clear: drought is an example of natural selection, I used it as an example, not as an example of what is not. Random changes in the environment are what drive natural selection. Drought is one such change. Those organisms better adapted to water scarcity survive, whereas those that don't, will die. Therefore, water scarcity is the selective pressure.
You can't say that genetic drift is the result of random events because it isn't. Random events alter the environment and therefore change the selective pressures. Therefore, random events are involved with natural selection, not drift. Drift is just the random collection of mutations in a genome. At the time they occur, they are selectively neutral, in that they confer no benefit nor detriment on the organism.

Just to clarify what HighTide said: the spliceosome isn't on the course. You need to know about the 5' cap (but not that it is 7-methylguanosine) and need to know about the poly-A tail. That's it

How much do we need to know about start and stop codons?
What are rRNA involved in, in terms of VCE?

You need to know their purpose. That start codons start TRANSLATION and stop codons stop TRANSLATION (don't fall into the trap of thinking they start and stop transcription).
R stands for ribosomal. A ribosome is a complex of RNA and protein. rRNA forms part of the structure of ribosomes.

[cosine]

Just to be clear: drought is an example of natural selection, I used it as an example, not as an example of what is not. Random changes in the environment are what drive natural selection. Drought is one such change. Those organisms better adapted to water scarcity survive, whereas those that don't, will die. Therefore, water scarcity is the selective pressure.
You can't say that genetic drift is the result of random events because it isn't. Random events alter the environment and therefore change the selective pressures. Therefore, random events are involved with natural selection, not drift. Drift is just the random collection of mutations in a genome. At the time they occur, they are selectively neutral, in that they confer no benefit nor detriment on the organism.

Just to clarify what HighTide said: the spliceosome isn't on the course. You need to know about the 5' cap (but not that it is 7-methylguanosine) and need to know about the poly-A tail. That's it

You need to know their purpose. That start codons start TRANSLATION and stop codons stop TRANSLATION (don't fall into the trap of thinking they start and stop transcription).
R stands for ribosomal. A ribosome is a complex of RNA and protein. rRNA forms part of the structure of ribosomes.

So the mRNA strand, does it code for every single codon it has? Like the first codon of an mRNA strand will always be the start codon, and the last codon on the mRNA strand will always be the stop codon? In other words, when exons are removed, will the strand of mRNA be like this:

start - ACACGAGCGACGGAGCGAGCGGCAG - stop    OR

ACGAGCGA - start - ACGAGCGAGCGAGC - stop - ACGAGCGA

Edit: Research tells me:

The pre mRNA transcript is modified after transcription and the first and final codons will always be the start and stop codons, and the introns in between the exons are spliced off, and the exons are joined together to form the mRNA molecule that has a poly A tail at the 3' end and a methylated cap at the 5' end.

Also, does this mean that the promoter region of the RNA polymerase is the start triplet on DNA?

[KingDrogba]

Ex Bio students, 3 weeks out from the exam, what is the best way i can elevate by high 80's in practice exams currently to the high 90's, I've been doing lots of past papers, making errors and reviewing those errors each day but i still struggle to get over that 85-90% barrier, seriously what else can i do? Or after 30 or so papers will something just click? I'm aiming for a really high score which i believe i can get but i know that dropping marks is costly in the exam.
Thank you in advance!

[vox nihili]

So the mRNA strand, does it code for every single codon it has? Like the first codon of an mRNA strand will always be the start codon, and the last codon on the mRNA strand will always be the stop codon? In other words, when exons are removed, will the strand of mRNA be like this:

start - ACACGAGCGACGGAGCGAGCGGCAG - stop    OR

ACGAGCGA - start - ACGAGCGAGCGAGC - stop - ACGAGCGA

Edit: Research tells me:

The pre mRNA transcript is modified after transcription and the first and final codons will always be the start and stop codons, and the introns in between the exons are spliced off, and the exons are joined together to form the mRNA molecule that has a poly A tail at the 3' end and a methylated cap at the 5' end.

Also, does this mean that the promoter region of the RNA polymerase is the start triplet on DNA?

Hmmm you're confusing codon with base. Codon means a group of three bases that CODES for a protein. Not strictly VCE, but before the start codon there's a region called the 5'-UTR and after the stop codon there's a region called the 3'-UTR. These are just strings of bases that flank the coding portion (i.e. the exons) of the mRNA.

The promoter region is a part of DNA, not of RNA polymerase. It sits upstream (i.e. before) the gene. The promoter is not part of the gene.

Overall lessen here: not all of the mRNA is turned into a protein.

Ex Bio students, 3 weeks out from the exam, what is the best way i can elevate by high 80's in practice exams currently to the high 90's, I've been doing lots of past papers, making errors and reviewing those errors each day but i still struggle to get over that 85-90% barrier, seriously what else can i do? Or after 30 or so papers will something just click? I'm aiming for a really high score which i believe i can get but i know that dropping marks is costly in the exam.
Thank you in advance!

Put all of your review in context, see what those areas of the course are that you keep making mistakes on and try to devise strategies to mitigate those mistakes. I'm glad to hear you're doing exams and looking at the errors, but you really need to do so actively. Don't just see what they are and identify your mistake, identify what you need to do to avoid that mistake next time or avoid similar mistakes.

[KingDrogba]

Do you suggest just going over specific topics that are re-occurring problems by reviewing material notes? I have flash cards per topic made throughout the year so perhaps going over those would help me? Cheers for the response, appreciate it!

[BakedDwarf]

Uhh, isn't the diploid number 14? The answer says its 7

Note: It doesn't let me attach the screenshot of the question - it says "Your attachment has failed security checks and cannot be uploaded. Please consult the forum administrator." Basically, its question 4c of the 2011 VCAA exam 2

[cosine]

Hmmm you're confusing codon with base. Codon means a group of three bases that CODES for a protein. Not strictly VCE, but before the start codon there's a region called the 5'-UTR and after the stop codon there's a region called the 3'-UTR. These are just strings of bases that flank the coding portion (i.e. the exons) of the mRNA.

The promoter region is a part of DNA, not of RNA polymerase. It sits upstream (i.e. before) the gene. The promoter is not part of the gene.

Overall lessen here: not all of the mRNA is turned into a protein.

(Image removed from quote.)

Put all of your review in context, see what those areas of the course are that you keep making mistakes on and try to devise strategies to mitigate those mistakes. I'm glad to hear you're doing exams and looking at the errors, but you really need to do so actively. Don't just see what they are and identify your mistake, identify what you need to do to avoid that mistake next time or avoid similar mistakes.

Alright so here is my understanding:

RNA polymerase binds to the promoter regions of the template DNA strand. (Still unclear here, so the promoter regions on the DNA are not within the gene, so the promoter region is outside the parameter of the start codon? If so, when the pre-mRNA is spliced, does this promoter region get spliced off? Or if what I said is false, would that mean the promoter region just promotes the RNA polymerase but does not actually get transcripted onto the mRNA?) Once this has occurred, the RNA polymerase moves along the DNA template strand in the 3'-5' direction, simultaneously synthesising the single stranded pre-mRNA molecule, as ribonucleotides are added by the ongoing polymerase to the progressing mRNA strand. As this happens, the mRNA strand peels off and is extending as it is being synthesised. The DNA helix is also being winded back together as the mRNA is being synthesised.